Browsing by Author "Mekonnen, Ephrem"

Now showing 1 - 2 of 2
  • No Thumbnail Available
    Item
    A Comparative Genetic-Epidemiological Study of Some lIuman Disease Traits and ABO Blood Groups among Different Population Categories in Harari Region of Ethiopia
    (Addis Ababa University, 2006-07) Mekonnen, Ephrem; Yussuf, Lukuman (PhD); Dagne, Kifle (PhD)
    A comparative Genetic-Epidemiological analysis was carried out in HarGl'i Region of Ethiopia (Region-I3) on the spectl1lm, ji-equency, and distribution of some selected human traits which have been described by several previous scientific investigations as being genetically determined: (I) Genetic diseases which arefolllld under various disease classification categories of the Ethiopian Minisfly of Health's "List of Causes for Tabulation of Morbidity and Mortality" and (2) the ABO blood groups. From all available medical data of IO-years (I984-I994 E.C.), a total sample of more thanI2,OOO cases of the various selected disease conditions were collected ji-om hospital inpatient belonging to different Population Categories (PCs) characterized by different 'Local Ethno-Geographic' backgrounds; and 279 blood samples were taken ji-Olll informed volunteers of the normal population with different ethnic origins-Oromo, Amhara, alld HarGl·i. The genetic disease samples collected ji'Oln hospital records of inpatient populations were grouped into four basic PCs that closely follow or approximate their historical settlement patterns as well as current administrative boundaries of HarGl'i Region, which are both presumed to be based upon and reflect the ethnic identities or composition of their respective inhabitants; the blood samples were grouped into three groups based 011 the ethnic origin of the volunteers. (1) The statistical analysis results with regard to the RFD of disease traits were found to be age and sex specific among the compared PC pairs. PC-I was found to be the most distinctive population categOlY of all in its RFD of those disease traits classified under Dxgroup- 2 (Neoplasms), Dxgroup-3 (Deficiency Diseases- Diabetes Mellitus and Diabetes Insipidus), and Dxgroup-6 (Diseases of the Nervous System and Sense Organs- Epilepsy, Cataract, and Glaucoma). PC-I showed no significant variation ji-om any of the other PCs ill its RFD of Dxgroup-I (Malaria), Dxgroup-9 (Diseases of the Digestive System), Dxgroup-IO (Diseases of the Genito-UrillGlY System), and Dxgroup-II (Diseases Associated with Pregnancy, Child Birth, and the Puelperium). (ll) The statistical tests concerning the ABO blood group samples obtained ji'Oln the three major ethnic groups in HarGl'i Regioll showed that (1) Phenotypic heterogeneity test: the total chi-square values for homogeneity were nOll-significant both among the (i) Oromo, Amhara, and HarGl'i entries, and (ii) Oromo and Amhara entries with Chi-square=5.932, df=6, p>O.05 and Chi-square=4.332, df= 3, p>O.05, respectively, indicating phenotypic homogeneity. (Similar tests on the other possible data combinations could not be pelformed due to insufficient data.) (2) Genetic-equilibriulll test: (i) the Chi-square values for genetic equilibrium were nonsignificant for both the Drama and Amhara entries indicating random intra-ethnic mating to the extent of reaching genetic equilibrium, (Similar tests on the Harm'i enl1y could not be pe/formed due to insufficient data.) (ii) the total Chi-square values for genetic equilibriulll were IlOnsignificant for the combined entries of the Drama, Amhara, and Harm'i as well as the combined entries of the Drama and Amhara indicating either that (a) there is random inter-ethnic mating between the populations ji'om which the samples were taken, or (b) the samples were taken ji'01l! different ethnic populations each of which are randomly mating within themselves and are all at genetiC equilibrium as well as possessing similar proportions of the alleles at the ABO locus, (iii) the total Chi-square vailles for genetic equilibrium were significant for the combined entries of the Drama and Harm'i as well as the combined entries of the Amhara and Harm'i indicating that the Harm'i do not engage in random inter-ethnic reproductive mixing with neither the Amhara nor the Drama, although they are genetically closer to the later than the former ethnic group,
  • No Thumbnail Available
    Item
    The Influence of Candidate Gene Polymorphisms in Tuberculosis Among Selected Ethiopian Populations
    (Addis Ababa University, 2018-04-05) Mekonnen, Ephrem
    Background: Tuberculosis (TB) is an ancient malady that remains a modern global health concern. The ancient relationship between Mycobacterium tuberculosis (Mtb) and Homo sapiens has evolved into a spectrum of co-existence pattern which, from the human perspective, ranges from a complete and fatal susceptibility to TB to a total resistance to infection and/or progression to disease. Essentially, therefore, infection by Mtb, although necessary, is not a sufficient cause for TB disease and numerous studies have demonstrated that this spectrum of host-pathogen interaction outcome is mediated in part by the genetic constitution of individuals that impact their potential for innate and adaptive immunity against TB. However, there is a conspicuous lack of replication of results and the hunt for novel associations in different populations continues unabated. It has been suggested that the lack of power in the investigative process to identify genetic risk factors to TB emanate mainly from the lack of precision in the 'Definition of the Phenotype'. Because of the complexity of TB, a precise and consistent definition of the disease is a major challenge and it has been difficult to provide reliable TB phenotype definition criteria amenable for genetic epidemiological analysis. There is also the possibility of unaccounted differences in the genetic architecture of the studied populations and the potentially differential or minor effects of either rare or common variants identified in the studies. The primary aim of this genetic epidemiological study was 1) to investigate the role of genetic variations within candidate genes towards susceptibility to TB by resequencing genes which previously showed an association signal in another Sub-Saharan African cohort (Ugandan population), as well as 2) testing an original candidate gene hypothesis in Ethiopian populations. The study focused on three innately expressed genes: NOD1 [Nucleotide-binding Oligmerization Domain containing 1] and TICAM2 [Toll/Interleukin-1 Receptor Domain-Containing Adaptor iv Molecule 2], based on a recent finding in an East African population that indicated significant statistical association and another study demonstrating a biological plausibility of TICAM2-NOD1 synergistic action and, thus, were deemed to warrant an effort to replicate those findings in an independent population; and, FMO2 (Flavin-Containing-Monooxygenase-2) that demonstrates some curious characteristics vis-à-vis TB that come from some immunologic, pharmacogenetic, and population/evolutionary genetics observations. First, FMO2 is highly expressed in activated pulmonary-macrophages regulating oxidative-stress level, an essential mechanism of innate immunity against TB. In contrast, FMO2 is regarded as potentially deleterious because it causes adverse reactions to anti-TB drug treatment. Furthermore, FMO2 possesses a unique polymorphism, FMO2*1/FMO2*2 (rs6661174), with differential ethno-geographic distribution. The functional ancestral-variant, FMO2*1, is only found in African and some Hispanic populations with highest frequency in Sub-Saharan-Africa while Caucasians and Asians are homozygous for the dysfunctional derived-allele, FMO2*2. However, there are no reported investigations into the potential involvement of FMO2 in the pathogenesis of diseases exerting population-specific selective pressures. Method: This study focused on finding a method of unraveling the TB-phenotype complexity by drawing TB-trait definitions closely based on its known natural progression stages from infection to disease onset. This ensures that intermediate stages of the disease are included as phenotypes of interest rather than just analyzing the final binary-trait outcome: 'Active-TB vs. No-active-TB' (presence/absence). An intermediate stage may be a distinct phenotype having its own immunogenetic profile that could otherwise be missed. TB cases and household controls (n=292) were ascertained from 3 different ethnic groups. Latent Mtb infection was determined v using Quantiferon to develop reliable TB progression phenotypes. Exonic regions of TICAM2, NOD1, and FMO2 genes were sequenced. Various statistical tests of association were done that accounted for possible confounding by sex, age, and population stratification. Result: Multiple SNPs in FMO2, TICAM2 and NOD1 were associated with TB. Among the most significant findings were two SNPs in NOD1 achieving a study-wide significance threshold: rs751770147 [p=7.28x10-05] and chr7:30477156(T), a novel variant, [p=1.04x10-04]. Three SNPs in TICAM2 were nominally associated with TB, including rs2288384 [p=0.003]. Haplotype-based association tests supported the SNP-based results. The study also identified for the first time an association between FMO2 and TB both at the SNP and haplotype level. Two novel SNPs achieved a study-wide significance [chr1:171181877(A), p=3.15E-07, OR=4.644 and chr1:171165749(T), p=3.32E-06, OR=6.825] while several SNPs (twenty two) showed nominal signals of association. The pattern of association suggested a protective effect of FMO2 against both active and latent TB with distinct genetic variants underlying the TB-progression pathway. Haplotype-based tests confirmed the SNP-based results with a single haplotype bearing the ancestral-and-functional FMO2*1 "C" allele ("AGCTCTACAATCCCCTCGTTGCGC") explaining the overall association (haplotype-specific-p=0.000103). Strikingly, not only was FMO2*1 associated with reduced risk to "Active TB" (p=0.0118, OR=0.496) but it also does not co-segregate with the other 5'-3' flanking top high-TB-risk alleles. Conclusion: The study design not only helped to replicate previous association signals of TICAM2 and NOD1 with TB but also identified novel genetic variants associated with TB in Ethiopian populations thus further validating the genes' involvement in TB pathogenesis. The vi study also identified for the first time the association of FMO2 gene with TB and provided an evidence for the existence of an evolutionary adaptation to an ancient disease based on the ancestral FMO2*1 polymorphism. The study sheds light on the possible impact of host-pathogen co-evolution on the present differential ethno-geographic distribution of the FMO2*1 variant that coincides with the origin of both humans and Mtb in Sub-Saharan Africa. The novel discovery calls for a revision of the notion that FMO2*1 is "potentially deleterious". Rather, the study indicates that FMO2*1 is associated with reduced risk to TB progression acting in a haplotypic framework. The finding also puts into question the prudence of prescribing thiourea based anti-TB drug treatment regimens for populations harbouring high proportions of FMO2*1 without genetic screening. The study examined multiple ethnic groups in Ethiopia, and found that the association results are robust to population stratification. As Ethiopia is considered to be the origin of both humanity and Mtb, these findings are of particular significance for understanding Mtb-human co-evolution and the genetic underpinnings of TB in general.